SubtiBank SubtiBank
pnpA [2019-08-01 13:01:00]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

pnpA [2019-08-01 13:01:00]

polynucleotide phosphorylase, RNase, involved in double-strand break repair
locus
BSU_16690
pI
4.89
mw
77.28 kDa
protein length
705 aa Sequence Blast
gene length
2118 bp Sequence Blast
function
DNA repair, competence development, RNA degradation
product
polynucleotide phosphorylase (PNPase)
essential
no
ec
2.7.7.8
synonyms
comR
Outlinks
KEGGBsubCycSubtiListUniProtExpression Browser

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.1|Exoribonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]

    • Gene

    Coordinates
    1,739,383 1,741,500

    Phenotypes of a mutant

  • The [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant is cold sensitive and sensitive to tetracyclin, it shows multiseptate filamentous growth [Pubmed|8636041]
  • The mutant is deficient in genetic competence (no expression of the late competence genes) [Pubmed|8825779]
  • The [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant exhibits reduced motility and reduced expression of the [SW|fla-che operon] resulting from accumulation of [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] mRNA [Pubmed|26857544]
  • The mutant overexpresses the ''trp'' and ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' operons.

    • The protein

    Catalyzed reaction/ biological activity

  • 3'-5' exoribonuclease, [SW|RNase]
  • PNPase degrades the trp mRNA from RNA-TRAP complex
  • degradation of the [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] mRNA from the 3' end, through the [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|Rho]-dependent terminator [Pubmed|26857544]
  • involved in double-strand break (DSB) repair via homologous recombination (HR) or non-homologous end-joining (NHEJ) [Pubmed|21859751]
  • degrades ssDNA (3' - 5') (stimulated by [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA], inhibited by [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]) [Pubmed|21859751]
  • can polymerize ssDNA at a free 3' OH end, stimulated by [protein|5680A06A74D3EC6310EF8677795511C75DB3059E|RecN] [Pubmed|21859751]

    • Protein family

  • polyribonucleotide nucleotidyltransferase family (single member, according to UniProt)

    • [SW|Domains]

  • [SW|KH domain] (aa 553 ... 618) (according to the Interpro database)
  • [SW|S1 domain] (aa 620 ... 691) (according to the Interpro database)

    • Structure

  • [PDB|5YJJ] (protein from ''Staphylococcus aureus'') [pubmed|29242153]
  • [PDB|3GCM] (protein from ''E. coli'', PNPase/RNase E micro-domain/RNA tetragonal crystal form )

    • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|27708634]

    • Additional information

  • required for the expression of late competence genes ''[gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]'' and ''[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]'', requirement bypassed by a ''[gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]'' disruption; may be necessary for modification of the ''[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]'' transcript (stabilization or translation activation)
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

    • Expression and Regulation

    Operons

    genes
    [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]

    • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
    • view in new tab

    Biological materials

    Mutant

  • GP1748 ([gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::aphA3), available in [SW|Jörg Stülke]'s lab, [Pubmed|27708634]
  • BKE16690 ([gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA
  • BKK16690 ([gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA

    • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP838, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP1342, available in [SW|Jörg Stülke]'s lab
  • for chromosomal expression of PnpA-Strep (cat): GP1002, available in [SW|Jörg Stülke]'s lab
  • for chromosomal expression of PnpA-Strep (spc): GP1038, available in [SW|Jörg Stülke]'s lab
  • pGP1439: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab

    • GFP fusion

  • GP1698 (in [SW|pBP43]), expression of '' pnpA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]

    • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]

    • FLAG-tag construct

  • GP1021 (spc, based on [SW|pGP1331]) [Pubmed|21803996], available in [SW|Jörg Stülke]'s lab
  • GP1076 (ermC) [Pubmed|21803996], available in [SW|Jörg Stülke]'s lab

    • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage]

    • References

    Reviews

  • 10087930,19215773,17514363,16733069,22568516,25155548,25292357,25878039,28117687,29651979,30340785

    • Original publications

  • 11948165,10572137,8825779,19433509,9811656,14976255,15995184,8825778,8636041,15805522,19193632,1707536,19633085,19638340,20360175,20418391,20572937,21803996,21862575,22198292,23529473,21859751,15378759,25099370,26797123,26857544,27708634,28238534,28334892,28516784,29242153,31041723

    • PNPase in ''E. coli

  • 19327365,21324911,18650428